| Detail of EST/Unigene TCMS40287 |
| Acc. | TCMS40287 |
| Internal Acc. | |
| Type | TC/Unigene |
| Annotation (Top 5 hits in Uniprot_trembl) | Rac-like GTP-binding protein RHO1 OS=Pisum sativum E-value=1e-98; Rac-like GTP-binding protein RHO1 OS=Beta vulgaris E-value=1e-96; Rac-like GTP-binding protein ARAC1 OS=Arabidopsis thaliana E-value=6e-96; Rac-like GTP-binding protein ARAC6 OS=Arabidopsis thaliana E-value=8e-96; Rac-like GTP-binding protein ARAC11 OS=Arabidopsis thaliana E-value=8e-96; |
| Length | 1124 nt |
| Species | Medicago sativa |
| Belonged EST Libraries | MS_TRI1 (2 ESTs); MS_CDS (1 ESTs); |
| Sequence | TTGGCAAAGATTTGTTTAAAGAACGAACGCTTCAACGGCAAAATTTCCCGGGTTCCCTGT |
| EST members of Unigene | CO514365 CO513370 AJ966571 |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Environmental Information Processing > Signal Transduction > ko04010 MAPK signaling pathway > K04392 Ras-related C3 botulinum toxin substrate 1; Environmental Information Processing > Signal Transduction > ko04370 VEGF signaling pathway > K04392 Ras-related C3 botulinum toxin substrate 1; Environmental Information Processing > Signal Transduction > ko04310 Wnt signaling pathway > K04392 Ras-related C3 botulinum toxin substrate 1 |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | 9.A.5 Peroxisomal protein importer PPI |
| Probeset |
Msa.1185.1.S1_at, Msa.1285.1.S1_at, Mtr.40463.1.S1_at, Mtr.51873.1.S1_s_at
|
| Corresponding NCBI Gene | 816290 |
| Trichome-related Gene from Literature | 816290 |