Detail of EST/Unigene TCMS40364 |
Acc. | TCMS40364 |
Internal Acc. | |
Type | TC/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | Sedoheptulose-1,7-bisphosphatase, chloroplastic OS=Spinacia oleracea E-value=8e-89; Sedoheptulose-1,7-bisphosphatase, chloroplastic OS=Arabidopsis thaliana E-value=6e-85; Sedoheptulose-1,7-bisphosphatase, chloroplastic OS=Triticum aestivum E-value=3e-77; Sedoheptulose-1,7-bisphosphatase, chloroplastic OS=Chlamydomonas reinhardtii E-value=3e-58; Fructose-1,6-bisphosphatase class 1 OS=Geobacter bemidjiensis (strain Bem / ATCC BAA-1014 / DSM 16622) E-value=2e-18; |
Length | 715 nt |
Species | Medicago sativa |
Belonged EST Libraries | MS_FAL_SSH (1 ESTs); MS_TRI1 (1 ESTs); |
Sequence | ACATAAGTGGTTCTAGGGCCTAAAACTCCCATAGCTGCAGCAACTTGATCTCTTCCTGTT |
EST members of Unigene | CO513462 EL610483 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Carbohydrate Metabolism > ko00051 Fructose and mannose metabolism > K03841 fructose-1,6-bisphosphatase I; Metabolism > Carbohydrate Metabolism > ko00010 Glycolysis / Gluconeogenesis > K03841 fructose-1,6-bisphosphatase I; Metabolism > Carbohydrate Metabolism > ko00030 Pentose phosphate pathway > K03841 fructose-1,6-bisphosphatase I; Metabolism > Energy Metabolism > ko00710 Carbon fixation in photosynthetic organisms > K03841 fructose-1,6-bisphosphatase I |
EC | 3.1.3.11 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
Msa.1197.1.S1_at
|
Corresponding NCBI Gene | 824746 |
Trichome-related Gene from Literature | N/A |