| Detail of EST/Unigene TCMS40415 |
| Acc. | TCMS40415 |
| Internal Acc. | |
| Type | TC/Unigene |
| Annotation (Top 5 hits in Uniprot_trembl) | Phosphoribulokinase, chloroplastic OS=Mesembryanthemum crystallinum E-value=4e-61; Phosphoribulokinase, chloroplastic OS=Triticum aestivum E-value=5e-57; Phosphoribulokinase, chloroplastic OS=Spinacia oleracea E-value=2e-55; Phosphoribulokinase, chloroplastic OS=Arabidopsis thaliana E-value=4e-55; Phosphoribulokinase, chloroplastic OS=Chlamydomonas reinhardtii E-value=3e-45; |
| Length | 611 nt |
| Species | Medicago sativa |
| Belonged EST Libraries | MS_TRI1 (2 ESTs); |
| Sequence | GGGGTCCCAAATAATCCTCTATCCAACTTAAACTCACTTCTTCTTCAAAAAAATTCTTTA |
| EST members of Unigene | CO516860 CO515613 |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
Msa.3176.1.S1_at
|
| Corresponding NCBI Gene | 840098 |
| Trichome-related Gene from Literature | N/A |