Detail of EST/Unigene TCMS40415 |
Acc. | TCMS40415 |
Internal Acc. | |
Type | TC/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | Phosphoribulokinase, chloroplastic OS=Mesembryanthemum crystallinum E-value=4e-61; Phosphoribulokinase, chloroplastic OS=Triticum aestivum E-value=5e-57; Phosphoribulokinase, chloroplastic OS=Spinacia oleracea E-value=2e-55; Phosphoribulokinase, chloroplastic OS=Arabidopsis thaliana E-value=4e-55; Phosphoribulokinase, chloroplastic OS=Chlamydomonas reinhardtii E-value=3e-45; |
Length | 611 nt |
Species | Medicago sativa |
Belonged EST Libraries | MS_TRI1 (2 ESTs); |
Sequence | GGGGTCCCAAATAATCCTCTATCCAACTTAAACTCACTTCTTCTTCAAAAAAATTCTTTA |
EST members of Unigene | CO516860 CO515613 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
Msa.3176.1.S1_at
|
Corresponding NCBI Gene | 840098 |
Trichome-related Gene from Literature | N/A |