| Detail of EST/Unigene TCMS40585 |
| Acc. | TCMS40585 |
| Internal Acc. | |
| Type | TC/Unigene |
| Annotation (Top 5 hits in Uniprot_trembl) | Photosystem I reaction center subunit N, chloroplastic OS=Arabidopsis thaliana E-value=6e-51; Photosystem I reaction center subunit N, chloroplastic OS=Hordeum vulgare E-value=7e-41; Photosystem I reaction center subunit N, chloroplastic (Fragment) OS=Zea mays E-value=2e-40; Photosystem I reaction center subunit N, chloroplastic OS=Volvox carteri E-value=4e-22; |
| Length | 640 nt |
| Species | Medicago sativa |
| Belonged EST Libraries | MS_TRI1 (2 ESTs); |
| Sequence | CTCTGATACACATCACAGATCAGCAGAACTAACTAGTAATCCACAATACACATGGCTGCA |
| EST members of Unigene | CO514593 CO512219 |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
Msa.1642.1.S1_at
|
| Corresponding NCBI Gene | 836525 |
| Trichome-related Gene from Literature | N/A |