Detail of EST/Unigene TCMS40585 |
Acc. | TCMS40585 |
Internal Acc. | |
Type | TC/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | Photosystem I reaction center subunit N, chloroplastic OS=Arabidopsis thaliana E-value=6e-51; Photosystem I reaction center subunit N, chloroplastic OS=Hordeum vulgare E-value=7e-41; Photosystem I reaction center subunit N, chloroplastic (Fragment) OS=Zea mays E-value=2e-40; Photosystem I reaction center subunit N, chloroplastic OS=Volvox carteri E-value=4e-22; |
Length | 640 nt |
Species | Medicago sativa |
Belonged EST Libraries | MS_TRI1 (2 ESTs); |
Sequence | CTCTGATACACATCACAGATCAGCAGAACTAACTAGTAATCCACAATACACATGGCTGCA |
EST members of Unigene | CO514593 CO512219 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
Msa.1642.1.S1_at
|
Corresponding NCBI Gene | 836525 |
Trichome-related Gene from Literature | N/A |