| Detail of EST/Unigene TCMS40634 |
| Acc. | TCMS40634 |
| Internal Acc. | |
| Type | TC/Unigene |
| Annotation (Top 5 hits in Uniprot_trembl) | Glutathione S-transferase T1 OS=Arabidopsis thaliana E-value=1e-77; Glutathione S-transferase T2 OS=Arabidopsis thaliana E-value=2e-75; Glutathione S-transferase T3 OS=Arabidopsis thaliana E-value=2e-72; Glutathione S-transferase theta-2 OS=Rattus norvegicus E-value=1e-30; Glutathione S-transferase theta-2 OS=Mus musculus E-value=8e-30; |
| Length | 595 nt |
| Species | Medicago sativa |
| Belonged EST Libraries | MS_TRI1 (2 ESTs); |
| Sequence | GGGGTGGTGAAGAAAGAAAGAAAGATGAAGCTGAAAGTGTATGCGGACCGTATGTCCCAG |
| EST members of Unigene | CO516111 CO512805 |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Metabolism > Xenobiotics Biodegradation and Metabolism > ko00982 Drug metabolism - cytochrome P450 > K00799 glutathione S-transferase; Metabolism > Xenobiotics Biodegradation and Metabolism > ko00980 Metabolism of xenobiotics by cytochrome P450 > K00799 glutathione S-transferase; Metabolism > Metabolism of Other Amino Acids > ko00480 Glutathione metabolism > K00799 glutathione S-transferase |
| EC | 2.5.1.18 |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
Msa.3153.1.S1_at, Mtr.26626.1.S1_s_at
|
| Corresponding NCBI Gene | 834123 |
| Trichome-related Gene from Literature | N/A |