Detail of EST/Unigene TCMS40651 |
Acc. | TCMS40651 |
Internal Acc. | |
Type | TC/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | Glutathione S-transferase F9 OS=Arabidopsis thaliana E-value=1e-60; Glutathione S-transferase F10 OS=Arabidopsis thaliana E-value=2e-59; Glutathione S-transferase F11 OS=Arabidopsis thaliana E-value=3e-46; Glutathione S-transferase F12 OS=Arabidopsis thaliana E-value=8e-43; Glutathione S-transferase F13 OS=Arabidopsis thaliana E-value=1e-42; |
Length | 579 nt |
Species | Medicago sativa |
Belonged EST Libraries | MS_TRI1 (2 ESTs); |
Sequence | CACAAACAAAACAAACAAGATACACTCCTCAATCTTGTGTCTCTGAAAACATGGTTGTGA |
EST members of Unigene | CO516356 CO515308 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Xenobiotics Biodegradation and Metabolism > ko00982 Drug metabolism - cytochrome P450 > K00799 glutathione S-transferase; Metabolism > Xenobiotics Biodegradation and Metabolism > ko00980 Metabolism of xenobiotics by cytochrome P450 > K00799 glutathione S-transferase; Metabolism > Metabolism of Other Amino Acids > ko00480 Glutathione metabolism > K00799 glutathione S-transferase |
EC | 2.5.1.18 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
Msa.1768.1.S1_at
|
Corresponding NCBI Gene | 817636 |
Trichome-related Gene from Literature | N/A |