Detail of EST/Unigene TCMS40807 |
Acc. | TCMS40807 |
Internal Acc. | |
Type | TC/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | Aldo-keto reductase family 4 member C9 OS=Arabidopsis thaliana E-value=0; Aldo-keto reductase family 4 member C10 OS=Arabidopsis thaliana E-value=0; Aldo-keto reductase family 4 member C11 OS=Arabidopsis thaliana E-value=0; Aldo-keto reductase family 4 member C8 OS=Arabidopsis thaliana E-value=0; Aldose reductase OS=Hordeum vulgare E-value=3e-62; |
Length | 1231 nt |
Species | Medicago sativa |
Belonged EST Libraries | MS_TRI1 (2 ESTs); MS_CDS (1 ESTs); |
Sequence | ATTCAATAAAAACCACATATTCATGGCTCCAAAATGGCCACAGCAATCAAGTTTTTTCAG |
EST members of Unigene | CO515758 CO513127 X97606 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Xenobiotics Biodegradation and Metabolism > ko00930 Caprolactam degradation > K00002 alcohol dehydrogenase (NADP+); Metabolism > Carbohydrate Metabolism > ko00010 Glycolysis / Gluconeogenesis > K00002 alcohol dehydrogenase (NADP+); Metabolism > Lipid Metabolism > ko00561 Glycerolipid metabolism > K00002 alcohol dehydrogenase (NADP+); Metabolism > Carbohydrate Metabolism > ko00051 Fructose and mannose metabolism > K00011 aldehyde reductase; Metabolism > Carbohydrate Metabolism > ko00052 Galactose metabolism > K00011 aldehyde reductase; Metabolism > Carbohydrate Metabolism > ko00040 Pentose and glucuronate interconversions > K00011 aldehyde reductase; Metabolism > Carbohydrate Metabolism > ko00620 Pyruvate metabolism > K00011 aldehyde reductase; Metabolism > Lipid Metabolism > ko00561 Glycerolipid metabolism > K00011 aldehyde reductase |
EC | 1.1.1.2 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
Msa.2968.1.S1_at, Mtr.46053.1.S1_at
|
Corresponding NCBI Gene | 818354 |
Trichome-related Gene from Literature | N/A |