Detail of EST/Unigene TCMS41155 |
Acc. | TCMS41155 |
Internal Acc. | |
Type | TC/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | Chlorophyll a-b binding protein AB80, chloroplastic OS=Pisum sativum E-value=0; Chlorophyll a-b binding protein 3C, chloroplastic OS=Solanum lycopersicum E-value=0; Chlorophyll a-b binding protein 40, chloroplastic OS=Nicotiana tabacum E-value=0; Chlorophyll a-b binding protein 16, chloroplastic OS=Nicotiana tabacum E-value=0; Chlorophyll a-b binding protein of LHCII type I, chloroplastic (Fragment) OS=Cucumis sativus E-value=0; |
Length | 1002 nt |
Species | Medicago sativa |
Belonged EST Libraries | MS_TRI2 (2 ESTs); |
Sequence | CCATCATCAACATTGCCAATAAAGATATTCATTTGTTTACTTAGTAAACACTAAAATTCT |
EST members of Unigene | EX523975 EX523141 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 839871 |
Trichome-related Gene from Literature | 839871 |