Detail of EST/Unigene TCMS41177 |
Acc. | TCMS41177 |
Internal Acc. | |
Type | TC/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | Ferredoxin-1, chloroplastic OS=Solanum lycopersicum E-value=1e-51; Ferredoxin, chloroplastic OS=Capsicum annuum E-value=5e-50; Ferredoxin-1, chloroplastic OS=Pisum sativum E-value=8e-48; Ferredoxin-2, chloroplastic OS=Arabidopsis thaliana E-value=1e-47; Ferredoxin-1, chloroplastic OS=Arabidopsis thaliana E-value=9e-46; |
Length | 636 nt |
Species | Medicago sativa |
Belonged EST Libraries | MS_TRI2 (2 ESTs); |
Sequence | AAACAAAAACATTTCTAGCCCTCTGCCTTGGTTTCTACTATACTAGCACACTTTTGCACA |
EST members of Unigene | EX523466 EX522581 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
Mtr.24508.1.S1_at
|
Corresponding NCBI Gene | N/A |
Trichome-related Gene from Literature | N/A |