| Detail of EST/Unigene TCMT40229 |
| Acc. | TCMT40229 |
| Internal Acc. | |
| Type | TC/Unigene |
| Annotation (Top 5 hits in Uniprot_trembl) | Flap endonuclease 1 OS=Glycine max E-value=6e-68; Flap endonuclease 1 OS=Arabidopsis thaliana E-value=5e-62; Flap endonuclease 1-A OS=Sorghum bicolor E-value=2e-59; Flap endonuclease 1 OS=Zea mays E-value=5e-59; Flap endonuclease 1-A OS=Oryza sativa subsp. japonica E-value=5e-59; |
| Length | 713 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MtBB_NOD (2 ESTs); |
| Sequence | AAAGATTTTGGAGGAGCTAGATTTGACCATGGACCAATTTATTGACTTATGTATACTTTC |
| EST members of Unigene | AL378679 AL378678 |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Genetic Information Processing > Replication and Repair > ko03410 Base excision repair > K04799 flap endonuclease-1; Genetic Information Processing > Replication and Repair > ko03030 DNA replication > K04799 flap endonuclease-1; Genetic Information Processing > Replication and Repair > ko03450 Non-homologous end-joining > K04799 flap endonuclease-1 |
| EC | 3.-.-.- |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
Mtr.14129.1.S1_at
|
| Corresponding NCBI Gene | 832721 |
| Trichome-related Gene from Literature | N/A |