Detail of EST/Unigene TCMT41055 |
Acc. | TCMT41055 |
Internal Acc. | |
Type | TC/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | UDP-glycosyltransferase 85A7 OS=Arabidopsis thaliana E-value=0; UDP-glycosyltransferase 85A1 OS=Arabidopsis thaliana E-value=0; UDP-glycosyltransferase 85A3 OS=Arabidopsis thaliana E-value=0; UDP-glycosyltransferase 85A5 OS=Arabidopsis thaliana E-value=0; UDP-glycosyltransferase 85A2 OS=Arabidopsis thaliana E-value=0; |
Length | 1623 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_JAS_ROOR (4 ESTs); MT_JCVI-MT2 (4 ESTs); MT_ECELL (3 ESTs); MT_SEEDROOT_KV3 (3 ESTs); MT_NOD_ROOT (2 ESTs); MT_PhoLEAF (2 ESTs); MT_Drought (1 ESTs); MT_INSECT (1 ESTs); |
Sequence | CACAAACTCAGAAATGAGTGATTCAAAACCACATGCAGTGTTAATTCCATATCCAGTTCA |
EST members of Unigene | BF645921 BF645876 BF643212 AW686612 AW686656 CB891411 BG587823 AW736317 BG458176 BG457792 CX532628 CX530070 CX529250 CX528866 BF635704 BF640880 GE352506 GE348206 GE349227 GE344117 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Xenobiotics Biodegradation and Metabolism > ko00982 Drug metabolism - cytochrome P450 > K00699 glucuronosyltransferase; Metabolism > Xenobiotics Biodegradation and Metabolism > ko00983 Drug metabolism - other enzymes > K00699 glucuronosyltransferase; Metabolism > Xenobiotics Biodegradation and Metabolism > ko00980 Metabolism of xenobiotics by cytochrome P450 > K00699 glucuronosyltransferase; Metabolism > Carbohydrate Metabolism > ko00040 Pentose and glucuronate interconversions > K00699 glucuronosyltransferase; Metabolism > Carbohydrate Metabolism > ko00500 Starch and sucrose metabolism > K00699 glucuronosyltransferase; Metabolism > Lipid Metabolism > ko00150 Androgen and estrogen metabolism > K00699 glucuronosyltransferase; Metabolism > Metabolism of Cofactors and Vitamins > ko00860 Porphyrin and chlorophyll metabolism > K00699 glucuronosyltransferase; Metabolism > Metabolism of Cofactors and Vitamins > ko00830 Retinol metabolism > K00699 glucuronosyltransferase |
EC | 2.4.1.17 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
Mtr.43403.1.S1_s_at
|
Corresponding NCBI Gene | 838841 |
Trichome-related Gene from Literature | N/A |