| Detail of EST/Unigene TCMT41254 |
| Acc. | TCMT41254 |
| Internal Acc. | |
| Type | TC/Unigene |
| Annotation (Top 5 hits in Uniprot_trembl) | Probable glutathione S-transferase OS=Glycine max E-value=3e-47; Glutathione S-transferase U7 OS=Arabidopsis thaliana E-value=2e-35; Glutathione S-transferase U2 OS=Arabidopsis thaliana E-value=9e-33; Glutathione S-transferase U1 OS=Arabidopsis thaliana E-value=9e-33; Glutathione S-transferase U8 OS=Arabidopsis thaliana E-value=1e-31; |
| Length | 763 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_UV-B (2 ESTs); MT_HOGA (1 ESTs); |
| Sequence | TAAGTGTTGCAATGGCTACAAATCAGGAACATGTGAAGCTTTTGGGAGCTACAGGAAGCC |
| EST members of Unigene | DY632971 DY632633 BG648408 |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Metabolism > Xenobiotics Biodegradation and Metabolism > ko00982 Drug metabolism - cytochrome P450 > K00799 glutathione S-transferase; Metabolism > Xenobiotics Biodegradation and Metabolism > ko00980 Metabolism of xenobiotics by cytochrome P450 > K00799 glutathione S-transferase; Metabolism > Metabolism of Other Amino Acids > ko00480 Glutathione metabolism > K00799 glutathione S-transferase; Metabolism > Xenobiotics Biodegradation and Metabolism > ko00643 Styrene degradation > K01800 maleylacetoacetate isomerase; Metabolism > Amino Acid Metabolism > ko00350 Tyrosine metabolism > K01800 maleylacetoacetate isomerase |
| EC | 2.5.1.18 5.2.1.2 |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
Msa.1436.1.S1_at, Mtr.28547.1.S1_s_at, Mtr.28547.1.S1_x_at
|
| Corresponding NCBI Gene | 817491 |
| Trichome-related Gene from Literature | N/A |