Detail of EST/Unigene TCMT42302 |
Acc. | TCMT42302 |
Internal Acc. | |
Type | TC/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | Ribulose bisphosphate carboxylase small chain, chloroplastic OS=Medicago sativa E-value=8e-36; Ribulose bisphosphate carboxylase small chain, chloroplastic OS=Pyrus pyrifolia E-value=1e-33; Ribulose bisphosphate carboxylase small chain, chloroplastic OS=Malus sp. E-value=1e-33; Ribulose bisphosphate carboxylase small chain 3A, chloroplastic OS=Pisum sativum E-value=6e-33; Ribulose bisphosphate carboxylase small chain 3C, chloroplastic OS=Pisum sativum E-value=6e-33; |
Length | 616 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_VILEAF (2 ESTs); |
Sequence | GTCGGCGAAAAACTTTTTTACACATACAACCAATCAGATTTTTCATGACACCACTTTTTT |
EST members of Unigene | CX521603 CX519412 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
Mtr.7329.1.S1_at
|
Corresponding NCBI Gene | 843029 |
Trichome-related Gene from Literature | 843029 |