Detail of EST/Unigene TCMT42971 |
Acc. | TCMT42971 |
Internal Acc. | |
Type | TC/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | Glutathione transferase GST 23 OS=Zea mays E-value=2e-36; Glutathione S-transferase U4 OS=Arabidopsis thaliana E-value=5e-36; Glutathione S-transferase U2 OS=Arabidopsis thaliana E-value=3e-35; Glutathione S-transferase U7 OS=Arabidopsis thaliana E-value=1e-34; Probable glutathione S-transferase OS=Glycine max E-value=2e-34; |
Length | 623 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_INSECT (1 ESTs); MT_JCVI-MT2 (1 ESTs); |
Sequence | GTTTGGTTAAAAGCGAAAATGGCAGAAGACTCACTCACGATACTAGGGTTCTGGGGTAGT |
EST members of Unigene | BF641363 GE343988 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Xenobiotics Biodegradation and Metabolism > ko00982 Drug metabolism - cytochrome P450 > K00799 glutathione S-transferase; Metabolism > Xenobiotics Biodegradation and Metabolism > ko00980 Metabolism of xenobiotics by cytochrome P450 > K00799 glutathione S-transferase; Metabolism > Metabolism of Other Amino Acids > ko00480 Glutathione metabolism > K00799 glutathione S-transferase |
EC | 2.5.1.18 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
Mtr.5646.1.S1_at
|
Corresponding NCBI Gene | 817495 |
Trichome-related Gene from Literature | N/A |