Detail of EST/Unigene TCMT43191 |
Acc. | TCMT43191 |
Internal Acc. | |
Type | TC/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | G-box-binding factor OS=Dictyostelium discoideum E-value=3e-09; Retrotransposon-derived protein PEG10 OS=Mus musculus E-value=5e-08; Histidine-rich glycoprotein OS=Plasmodium lophurae E-value=6e-07; Hybrid signal transduction histidine kinase L OS=Dictyostelium discoideum E-value=1e-06; Putative cyclin-dependent serine/threonine-protein kinase DDB_G0272797/DDB_G0274007 OS=Dictyostelium discoideum E-value=2e-06; |
Length | 691 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_TRI (198 ESTs); |
Sequence | ANATCTCAGTTGTGTAAGATACAAACAAAATTTCATATGGCAACTTCAAAAGTTCTAAGC |
EST members of Unigene | EX533296 EX533268 EX533267 EX533265 EX533250 EX533245 EX533218 EX533202 EX533186 EX533174 EX533141 EX533105 EX533071 EX533044 EX533001 EX532952 EX532859 EX532805 EX532772 EX532740 EX532724 EX532699 EX532641 EX532604 EX532449 EX532444 EX532436 EX532422 EX532418 EX532390 EX532359 EX532343 EX532327 EX532257 EX532243 EX532238 EX532221 EX532208 EX532189 EX532184 EX532158 EX532157 EX532105 EX532104 EX532096 EX531991 EX531962 EX531950 EX531936 EX531918 EX531902 EX531800 EX531784 EX531766 EX531699 EX531606 EX531563 EX531524 EX531496 EX531487 EX531454 EX531444 EX531412 EX531388 EX531376 EX531367 EX531281 EX531278 EX531221 EX531204 EX531187 EX531175 EX531154 EX531152 EX531141 EX531101 EX531028 EX531022 EX531012 EX530917 EX530856 EX530853 EX530830 EX530823 EX530790 EX530773 EX530758 EX530720 EX530706 EX530683 EX530620 EX530249 EX530215 EX530163 EX530066 EX529861 EX529785 EX529721 EX529585 EX529348 EX529261 EX529258 EX529129 EX528984 EX528954 EX528755 EX528707 EX528495 EX528458 EX528201 EX528150 EX528146 EX528097 EX528090 EX528042 EX527998 EX527922 EX527818 EX527762 EX527754 EX527730 EX527623 EX527571 EX527533 EX527460 EX527441 EX527362 EX526985 EX526931 EX526901 EX526817 EX526756 EX526694 EX526632 EX526596 EX526519 EX526488 EX526484 EX526449 EX526399 EX526310 EX526302 EX526286 EX526219 EX526179 EX526150 EX526148 EX526127 EX526112 EX526065 EX526018 ES613892 ES613750 ES613624 ES613596 ES613578 ES613450 ES613428 ES613359 ES613321 ES613313 ES613293 ES613263 ES613175 ES613167 ES613068 ES612975 ES612927 ES612804 ES612725 ES612601 ES612532 ES612439 ES612381 ES612370 ES612324 ES612279 ES612245 ES612207 ES612177 ES612076 ES612005 ES611983 ES611981 ES611805 ES611709 ES611700 ES611664 ES611530 ES611393 ES611383 ES611369 ES611331 ES611204 ES611167 ES611106 ES611090 ES610898 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Environmental Information Processing > Signal Transduction > ko04330 Notch signaling pathway > K06058 deltex |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
Mtr.22715.1.S1_s_at
|
Corresponding NCBI Gene | 830821 |
Trichome-related Gene from Literature | N/A |