Detail of EST/Unigene TCMT43558 |
Acc. | TCMT43558 |
Internal Acc. | |
Type | TC/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | Acyl-coenzyme A oxidase 3, peroxisomal OS=Arabidopsis thaliana E-value=0; Putative acyl-coenzyme A oxidase 3.2, peroxisomal OS=Arabidopsis thaliana E-value=0; Putative acyl-coenzyme A oxidase At3g06690 OS=Arabidopsis thaliana E-value=3e-60; Acyl-coenzyme A oxidase, peroxisomal OS=Cucurbita maxima E-value=2e-30; Acyl-coenzyme A oxidase 2, peroxisomal OS=Arabidopsis thaliana E-value=2e-28; |
Length | 1159 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_JAS_ROOR (2 ESTs); MT_HOGA (2 ESTs); MT_ECELL (1 ESTs); |
Sequence | GGTTTGCAGCATTCTTAGCCCCTCTGACCTCTGGTCGTGTAACTATTGGCCGTCAGTTCT |
EST members of Unigene | BF650857 CX530556 CX530031 CB894001 BG647119 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Lipid Metabolism > ko00592 alpha-Linolenic acid metabolism > K00232 acyl-CoA oxidase; Metabolism > Lipid Metabolism > ko01040 Biosynthesis of unsaturated fatty acids > K00232 acyl-CoA oxidase; Metabolism > Lipid Metabolism > ko00071 Fatty acid metabolism > K00232 acyl-CoA oxidase |
EC | 1.3.3.6 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
Msa.2776.1.S1_at, Mtr.43319.1.S1_at
|
Corresponding NCBI Gene | 837140 |
Trichome-related Gene from Literature | N/A |