Detail of EST/Unigene TCMT44174 |
Acc. | TCMT44174 |
Internal Acc. | |
Type | TC/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | Probable glutathione S-transferase parC OS=Nicotiana tabacum E-value=1e-70; Probable glutathione S-transferase OS=Nicotiana tabacum E-value=4e-70; Glutathione S-transferase U19 OS=Arabidopsis thaliana E-value=4e-67; Glutathione S-transferase 3 OS=Glycine max E-value=1e-66; Glutathione S-transferase U20 OS=Arabidopsis thaliana E-value=8e-65; |
Length | 798 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_JCVI-MT2 (2 ESTs); MT_BML (1 ESTs); |
Sequence | AAAAATTGCTATATTGTTTTCTTCACATAAAAAATAAGGGAAAATAATTATATTGTTTTT |
EST members of Unigene | GE348994 GE343852 GD185216 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Xenobiotics Biodegradation and Metabolism > ko00982 Drug metabolism - cytochrome P450 > K00799 glutathione S-transferase; Metabolism > Xenobiotics Biodegradation and Metabolism > ko00980 Metabolism of xenobiotics by cytochrome P450 > K00799 glutathione S-transferase; Metabolism > Metabolism of Other Amino Acids > ko00480 Glutathione metabolism > K00799 glutathione S-transferase |
EC | 2.5.1.18 |
Transcription Factor Family | |
Transporter Classification Family | 1.A.1 Voltage-gated ion channel superfamily VIC; 1.A.12 Organellar chloride channel O-ClC |
Probeset |
Mtr.33524.1.S1_at, Mtr.35528.1.S1_at
|
Corresponding NCBI Gene | 844174 |
Trichome-related Gene from Literature | N/A |