Detail of EST/Unigene TCMT45205 |
Acc. | TCMT45205 |
Internal Acc. | |
Type | TC/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | Geraniol 8-hydroxylase OS=Catharanthus roseus E-value=0; Cytochrome P450 76C2 OS=Arabidopsis thaliana E-value=2e-97; Cytochrome P450 76C4 OS=Arabidopsis thaliana E-value=4e-97; Cytochrome P450 76C1 OS=Arabidopsis thaliana E-value=4e-95; Cytochrome P450 76C3 OS=Arabidopsis thaliana E-value=2e-92; |
Length | 1347 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_GPOD (3 ESTs); |
Sequence | ACTAATTTCCTTTGTAAGTGCAAGCATCCTCATCCTCATTCTTAGAAAATTAAACCAAAC |
EST members of Unigene | CA918016 CA917581 CA917001 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Lipid Metabolism > ko00140 C21-Steroid hormone metabolism > K00512 cytochrome P450, family 17, subfamily A (steroid 17alpha-monooxygenase); Metabolism > Xenobiotics Biodegradation and Metabolism > ko00980 Metabolism of xenobiotics by cytochrome P450 > K07408 cytochrome P450, family 1, subfamily A, polypeptide 1; Metabolism > Amino Acid Metabolism > ko00380 Tryptophan metabolism > K07408 cytochrome P450, family 1, subfamily A, polypeptide 1; Metabolism > Metabolism of Cofactors and Vitamins > ko00830 Retinol metabolism > K07408 cytochrome P450, family 1, subfamily A, polypeptide 1 |
EC | 1.14.14.1 1.14.99.9 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
Mtr.10693.1.S1_at
|
Corresponding NCBI Gene | 825276 |
Trichome-related Gene from Literature | N/A |