| Detail of EST/Unigene TCMT45614 |
| Acc. | TCMT45614 |
| Internal Acc. | |
| Type | TC/Unigene |
| Annotation (Top 5 hits in Uniprot_trembl) | Exostosin-like 3 OS=Mus musculus E-value=2e-07; Exostosin-like 3 OS=Homo sapiens E-value=2e-07; Exostosin-2 OS=Mus musculus E-value=5e-07; Exostosin-2 OS=Homo sapiens E-value=6e-07; Exostosin-2 OS=Bos taurus E-value=6e-07; |
| Length | 851 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_SEEDROOT_KV3 (1 ESTs); MT_FLOSEED_MTY (1 ESTs); |
| Sequence | ATATTGCGTGCATCAACCAAAATCTCTGAACTCCGAACCAAAAACAGCACCGTTCTCACA |
| EST members of Unigene | DW017968 CB892234 |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Metabolism > Glycan Biosynthesis and Metabolism > ko01030 Glycan structures - Biosynthesis 1 > K02367 glucuronyl/N-acetylglucosaminyl transferase EXT2; Metabolism > Glycan Biosynthesis and Metabolism > ko00534 Heparan sulfate biosynthesis > K02367 glucuronyl/N-acetylglucosaminyl transferase EXT2; Metabolism > Glycan Biosynthesis and Metabolism > ko01030 Glycan structures - Biosynthesis 1 > K02370 alpha-1,4-N-acetylglucosaminyltransferase EXTL3; Metabolism > Glycan Biosynthesis and Metabolism > ko00534 Heparan sulfate biosynthesis > K02370 alpha-1,4-N-acetylglucosaminyltransferase EXTL3 |
| EC | 2.4.1.223 2.4.1.224 2.4.1.225 |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
Mtr.9506.1.S1_at
|
| Corresponding NCBI Gene | 824749 |
| Trichome-related Gene from Literature | N/A |