Detail of EST/Unigene TCMT45623 |
Acc. | TCMT45623 |
Internal Acc. | |
Type | TC/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | DNA ligase 1 OS=Arabidopsis thaliana E-value=3e-90; DNA ligase 1 OS=Dictyostelium discoideum E-value=7e-48; DNA ligase 1 OS=Xenopus laevis E-value=1e-44; DNA ligase 1 OS=Mus musculus E-value=1e-43; DNA ligase 1 OS=Rattus norvegicus E-value=8e-42; |
Length | 850 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_SROOT_KV2 (2 ESTs); |
Sequence | CTCAAAACCCTAGAAACTGCTCAAAAACCCGAAGAAACTGTTCATGAAGAACCGCCGAGC |
EST members of Unigene | BM779597 BM779542 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Genetic Information Processing > Replication and Repair > ko03410 Base excision repair > K10747 DNA ligase 1; Genetic Information Processing > Replication and Repair > ko03030 DNA replication > K10747 DNA ligase 1; Genetic Information Processing > Replication and Repair > ko03430 Mismatch repair > K10747 DNA ligase 1; Genetic Information Processing > Replication and Repair > ko03420 Nucleotide excision repair > K10747 DNA ligase 1 |
EC | 6.5.1.1 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
Mtr.42631.1.S1_at
|
Corresponding NCBI Gene | 837333 |
Trichome-related Gene from Literature | N/A |