| Detail of EST/Unigene TCMT45935 |
| Acc. | TCMT45935 |
| Internal Acc. | |
| Type | TC/Unigene |
| Annotation (Top 5 hits in Uniprot_trembl) | Probable glutathione S-transferase OS=Glycine max E-value=3e-87; Glutathione S-transferase U7 OS=Arabidopsis thaliana E-value=7e-55; Glutathione S-transferase U8 OS=Arabidopsis thaliana E-value=7e-53; Probable glutathione S-transferase OS=Nicotiana tabacum E-value=8e-49; Probable glutathione S-transferase OS=Nicotiana tabacum E-value=2e-48; |
| Length | 674 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_DSIL (1 ESTs); MT_Drought (1 ESTs); |
| Sequence | TCAGAGAGAAAATTGTTGAGTTGCAATCAATGGCTACAAATCAAGAAGATGTGAAACTTT |
| EST members of Unigene | BF520924 BG450082 |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Metabolism > Metabolism of Other Amino Acids > ko00480 Glutathione metabolism > K00310 pyrimidodiazepine synthase; Metabolism > Xenobiotics Biodegradation and Metabolism > ko00982 Drug metabolism - cytochrome P450 > K00799 glutathione S-transferase; Metabolism > Xenobiotics Biodegradation and Metabolism > ko00980 Metabolism of xenobiotics by cytochrome P450 > K00799 glutathione S-transferase; Metabolism > Metabolism of Other Amino Acids > ko00480 Glutathione metabolism > K00799 glutathione S-transferase |
| EC | 1.5.4.1 1.8.5.1 2.5.1.18 2.8.-.- |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
Mtr.39734.1.S1_at
|
| Corresponding NCBI Gene | 817491 |
| Trichome-related Gene from Literature | N/A |