Detail of EST/Unigene TCMT46240 |
Acc. | TCMT46240 |
Internal Acc. | |
Type | TC/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | Cyanogenic beta-glucosidase (Fragment) OS=Trifolium repens E-value=0; Non-cyanogenic beta-glucosidase OS=Trifolium repens E-value=0; Beta-glucosidase 12 OS=Oryza sativa subsp. japonica E-value=0; Beta-glucosidase 10 OS=Oryza sativa subsp. japonica E-value=1e-96; Beta-glucosidase 13 OS=Oryza sativa subsp. japonica E-value=3e-95; |
Length | 788 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_DROOT (1 ESTs); MT_SROOT_KV0 (1 ESTs); |
Sequence | AATTGCTTTTGCACTGGGGCTTGGCAAGGCAAATGTCAATTGCATAGAAACTATTGAAGT |
EST members of Unigene | BE320049 BE205305 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Carbohydrate Metabolism > ko00052 Galactose metabolism > K01229 lactase; Metabolism > Biosynthesis of Secondary Metabolites > ko00940 Phenylpropanoid biosynthesis > K05350 beta-glucosidase; Metabolism > Carbohydrate Metabolism > ko00500 Starch and sucrose metabolism > K05350 beta-glucosidase; Metabolism > Metabolism of Other Amino Acids > ko00460 Cyanoamino acid metabolism > K05350 beta-glucosidase |
EC | 3.2.1.108 3.2.1.21 3.2.1.62 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
Mtr.45003.1.S1_at
|
Corresponding NCBI Gene | 834231 |
Trichome-related Gene from Literature | N/A |