Detail of EST/Unigene TCMT48014 |
Acc. | TCMT48014 |
Internal Acc. | |
Type | TC/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | Vicianin hydrolase (Fragment) OS=Vicia sativa subsp. nigra E-value=6e-72; Beta-glucosidase 12 OS=Oryza sativa subsp. japonica E-value=4e-44; Beta-glucosidase 13 OS=Oryza sativa subsp. japonica E-value=3e-43; Beta-glucosidase 10 OS=Oryza sativa subsp. japonica E-value=4e-42; Beta-glucosidase 11 OS=Oryza sativa subsp. japonica E-value=4e-40; |
Length | 639 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_GESD (1 ESTs); MT_PhoLEAF (1 ESTs); |
Sequence | AACCCTATATCAACATGACCTACTTCACTGATATGCAAGCAAACCTCATTCCAATGAAGA |
EST members of Unigene | BI311175 BI263005 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Biosynthesis of Secondary Metabolites > ko00940 Phenylpropanoid biosynthesis > K05350 beta-glucosidase; Metabolism > Carbohydrate Metabolism > ko00500 Starch and sucrose metabolism > K05350 beta-glucosidase; Metabolism > Metabolism of Other Amino Acids > ko00460 Cyanoamino acid metabolism > K05350 beta-glucosidase |
EC | 3.2.1.21 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
Mtr.22379.1.S1_s_at
|
Corresponding NCBI Gene | 819055 |
Trichome-related Gene from Literature | N/A |