| Detail of EST/Unigene TCMT48713 |
| Acc. | TCMT48713 |
| Internal Acc. | |
| Type | TC/Unigene |
| Annotation (Top 5 hits in Uniprot_trembl) | Calcineurin subunit B OS=Neurospora crassa (strain ATCC 24698 / 74-OR23-1A / CBS 708.71 / DSM 1257 / FGSC 987) E-value=1e-67; Calcineurin subunit B OS=Cryptococcus neoformans var. neoformans serotype D (strain JEC21 / ATCC MYA-565) E-value=2e-65; Calcineurin subunit B OS=Cryptococcus neoformans var. neoformans serotype D (strain B-3501A) E-value=2e-65; Calcineurin subunit B OS=Schizosaccharomyces pombe (strain 972 / ATCC 24843) E-value=1e-59; Calcineurin subunit B OS=Yarrowia lipolytica (strain CLIB 122 / E 150) E-value=1e-58; |
| Length | 732 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MtBC_GLOMUS (2 ESTs); |
| Sequence | AAAAGCAATTTCACTTCAGAAGAGATCCAAAGACTTTATAAAAGGTTTATGAAACTTGAC |
| EST members of Unigene | AL388137 AL388136 |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Environmental Information Processing > Signal Transduction > ko04020 Calcium signaling pathway > K06268 protein phosphatase 3, regulatory subunit; Environmental Information Processing > Signal Transduction > ko04010 MAPK signaling pathway > K06268 protein phosphatase 3, regulatory subunit; Environmental Information Processing > Signal Transduction > ko04370 VEGF signaling pathway > K06268 protein phosphatase 3, regulatory subunit; Environmental Information Processing > Signal Transduction > ko04310 Wnt signaling pathway > K06268 protein phosphatase 3, regulatory subunit |
| EC | 3.1.3.16 |
| Transcription Factor Family | |
| Transporter Classification Family | 5.B.1 Phagocyte NADPH oxidase Gp91phox |
| Probeset |
Mtr.42508.1.S1_at
|
| Corresponding NCBI Gene | 821372 |
| Trichome-related Gene from Literature | N/A |