Detail of EST/Unigene TCMT48766 |
Acc. | TCMT48766 |
Internal Acc. | |
Type | TC/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | Aldo-keto reductase family 4 member C10 OS=Arabidopsis thaliana E-value=8e-30; Aldo-keto reductase family 4 member C9 OS=Arabidopsis thaliana E-value=4e-29; Aldo-keto reductase family 4 member C11 OS=Arabidopsis thaliana E-value=1e-27; Aldo-keto reductase family 4 member C8 OS=Arabidopsis thaliana E-value=3e-23; Alcohol dehydrogenase [NADP(+)] OS=Pongo abelii E-value=7e-19; |
Length | 595 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_DSIL (2 ESTs); |
Sequence | CATTACTTTCAATATGCTCCGAAAAATTTGTTAAGAGAATCATGCAATGATCCACCTTTT |
EST members of Unigene | BF519681 BF519680 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Xenobiotics Biodegradation and Metabolism > ko00930 Caprolactam degradation > K00002 alcohol dehydrogenase (NADP+); Metabolism > Carbohydrate Metabolism > ko00010 Glycolysis / Gluconeogenesis > K00002 alcohol dehydrogenase (NADP+); Metabolism > Lipid Metabolism > ko00561 Glycerolipid metabolism > K00002 alcohol dehydrogenase (NADP+) |
EC | 1.1.1.2 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
Mtr.27912.1.S1_at
|
Corresponding NCBI Gene | 818356 |
Trichome-related Gene from Literature | N/A |