| Detail of EST/Unigene TCMT49058 |
| Acc. | TCMT49058 |
| Internal Acc. | |
| Type | TC/Unigene |
| Annotation (Top 5 hits in Uniprot_trembl) | Cytochrome P450 71D11 (Fragment) OS=Lotus japonicus E-value=2e-53; Cytochrome P450 71D7 OS=Solanum chacoense E-value=4e-50; Cytochrome P450 71D6 OS=Solanum chacoense E-value=1e-46; 5-epiaristolochene 1,3-dihydroxylase OS=Nicotiana tabacum E-value=2e-46; Cytochrome P450 71D9 OS=Glycine max E-value=2e-45; |
| Length | 770 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_SEEDROOT_KV3 (1 ESTs); MtRHE (1 ESTs); |
| Sequence | CTTTCCAAATGGAGAATAATTTCTTATGGTTCTCCATTCTTTTGAGTCTTATAGTCTTAA |
| EST members of Unigene | CB892537 AA660324 |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Metabolism > Lipid Metabolism > ko00140 C21-Steroid hormone metabolism > K00512 cytochrome P450, family 17, subfamily A (steroid 17alpha-monooxygenase); Metabolism > Xenobiotics Biodegradation and Metabolism > ko00980 Metabolism of xenobiotics by cytochrome P450 > K07408 cytochrome P450, family 1, subfamily A, polypeptide 1; Metabolism > Amino Acid Metabolism > ko00380 Tryptophan metabolism > K07408 cytochrome P450, family 1, subfamily A, polypeptide 1; Metabolism > Metabolism of Cofactors and Vitamins > ko00830 Retinol metabolism > K07408 cytochrome P450, family 1, subfamily A, polypeptide 1 |
| EC | 1.14.14.1 1.14.99.9 |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
Mtr.45409.1.S1_at
|
| Corresponding NCBI Gene | 837865 |
| Trichome-related Gene from Literature | N/A |