| Detail of EST/Unigene TCMT50295 |
| Acc. | TCMT50295 |
| Internal Acc. | |
| Type | TC/Unigene |
| Annotation (Top 5 hits in Uniprot_trembl) | F-box/WD repeat-containing protein 11 OS=Mus musculus E-value=1e-08; F-box/WD repeat-containing protein 11 OS=Homo sapiens E-value=1e-08; Beta-TrCP OS=Xenopus laevis E-value=2e-08; F-box/WD repeat-containing protein 1A OS=Mus musculus E-value=2e-08; F-box/WD repeat-containing protein 1A OS=Homo sapiens E-value=2e-08; |
| Length | 881 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_NOD_ROOT (1 ESTs); MT_INSECT (1 ESTs); |
| Sequence | TTTTTTTATCACAACCCAAAAACAGGGCAAAAATGAAAATTTTCATTCTCTTTACAAACT |
| EST members of Unigene | AW684598 BI266083 |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Genetic Information Processing > Folding, Sorting and Degradation > ko04120 Ubiquitin mediated proteolysis > K03362 F-box and WD-40 domain protein 1/11; Environmental Information Processing > Signal Transduction > ko04340 Hedgehog signaling pathway > K03362 F-box and WD-40 domain protein 1/11; Environmental Information Processing > Signal Transduction > ko04310 Wnt signaling pathway > K03362 F-box and WD-40 domain protein 1/11 |
| EC | 6.3.2.19 |
| Transcription Factor Family | C3H |
| Transporter Classification Family | |
| Probeset |
Mtr.42388.1.S1_at
|
| Corresponding NCBI Gene | 839025 |
| Trichome-related Gene from Literature | N/A |