Detail of EST/Unigene TCMT50914 |
Acc. | TCMT50914 |
Internal Acc. | |
Type | TC/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | Ribonucleoside-diphosphate reductase large subunit OS=Arabidopsis thaliana E-value=0; Ribonucleoside-diphosphate reductase large subunit OS=Homo sapiens E-value=0; Ribonucleoside-diphosphate reductase large subunit OS=Pongo abelii E-value=0; Ribonucleoside-diphosphate reductase large subunit OS=Mus musculus E-value=0; Ribonucleoside-diphosphate reductase large subunit OS=Danio rerio E-value=0; |
Length | 1159 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MtBB_NOD (2 ESTs); MT_DROOT (1 ESTs); MT_GESD (1 ESTs); MT_SEEDROOT_KV3 (1 ESTs); |
Sequence | TGCAGGCTCAACAGTTAAACAAGGATATTTTTGAGACTATATACTACCATGCTCTGAAAA |
EST members of Unigene | AL377396 AL377395 BG448576 CA990462 AW774430 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Nucleotide Metabolism > ko00230 Purine metabolism > K10807 ribonucleoside-diphosphate reductase subunit M1; Metabolism > Nucleotide Metabolism > ko00240 Pyrimidine metabolism > K10807 ribonucleoside-diphosphate reductase subunit M1; Metabolism > Metabolism of Other Amino Acids > ko00480 Glutathione metabolism > K10807 ribonucleoside-diphosphate reductase subunit M1 |
EC | 1.17.4.1 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
Mtr.11322.1.S1_at, Mtr.45868.1.S1_s_at
|
Corresponding NCBI Gene | 816715 |
Trichome-related Gene from Literature | N/A |