| Detail of EST/Unigene TCMT50928 |
| Acc. | TCMT50928 |
| Internal Acc. | |
| Type | TC/Unigene |
| Annotation (Top 5 hits in Uniprot_trembl) | Uncharacterized oxidoreductase ybiC OS=Escherichia coli (strain K12) E-value=2e-96; Uncharacterized oxidoreductase ybiC OS=Escherichia coli O157:H7 E-value=7e-95; L-lactate dehydrogenase OS=Cupriavidus necator (strain ATCC 17699 / H16 / DSM 428 / Stanier 337) E-value=9e-19; L-sulfolactate dehydrogenase OS=Methanocaldococcus jannaschii (strain ATCC 43067 / DSM 2661 / JAL-1 / JCM 10045 / NBRC 100440) E-value=3e-15; Uncharacterized oxidoreductase PA1252 OS=Pseudomonas aeruginosa (strain ATCC 15692 / PAO1 / 1C / PRS 101 / LMG 12228) E-value=5e-14; |
| Length | 616 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_Drought (4 ESTs); MT_GESD (1 ESTs); |
| Sequence | GACATCCAGCGTGAAATTCCTGCTTCTGCCGTTCGCGACGCGTGTTCACTTCCCACTCGC |
| EST members of Unigene | BI311858 BG450832 BE248217 BE249171 BF632532 |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Metabolism > Carbohydrate Metabolism > ko00020 Citrate cycle (TCA cycle) > K00025 malate dehydrogenase; Metabolism > Carbohydrate Metabolism > ko00630 Glyoxylate and dicarboxylate metabolism > K00025 malate dehydrogenase; Metabolism > Carbohydrate Metabolism > ko00620 Pyruvate metabolism > K00025 malate dehydrogenase; Metabolism > Energy Metabolism > ko00710 Carbon fixation in photosynthetic organisms > K00025 malate dehydrogenase; Metabolism > Energy Metabolism > ko00720 Reductive carboxylate cycle (CO2 fixation) > K00025 malate dehydrogenase |
| EC | 1.-.-.- 1.1.1.37 |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
Mtr.3863.1.S1_at
|
| Corresponding NCBI Gene | N/A |
| Trichome-related Gene from Literature | N/A |