| Detail of EST/Unigene TCMT51053 |
| Acc. | TCMT51053 |
| Internal Acc. | |
| Type | TC/Unigene |
| Annotation (Top 5 hits in Uniprot_trembl) | Cytochrome P450 71A1 OS=Persea americana E-value=7e-51; Cytochrome P450 71A21 OS=Arabidopsis thaliana E-value=3e-50; Cytochrome P450 71A24 OS=Arabidopsis thaliana E-value=9e-48; Cytochrome P450 71A20 OS=Arabidopsis thaliana E-value=2e-46; Indoleacetaldoxime dehydratase OS=Arabidopsis thaliana E-value=8e-46; |
| Length | 804 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_FLOSEED_MTY (1 ESTs); MT_DFLOWER (1 ESTs); MT_DSTEM2 (1 ESTs); MT_JCVI-MT1 (1 ESTs); |
| Sequence | GAAGATGTGTTTGGACAAACAATGGTTCTCAAAATATGGTCACATGAACAAATTAAAGGA |
| EST members of Unigene | AW696374 EV261116 DW018939 BQ148201 |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Metabolism > Lipid Metabolism > ko00140 C21-Steroid hormone metabolism > K00512 cytochrome P450, family 17, subfamily A (steroid 17alpha-monooxygenase); Metabolism > Xenobiotics Biodegradation and Metabolism > ko00980 Metabolism of xenobiotics by cytochrome P450 > K07408 cytochrome P450, family 1, subfamily A, polypeptide 1; Metabolism > Amino Acid Metabolism > ko00380 Tryptophan metabolism > K07408 cytochrome P450, family 1, subfamily A, polypeptide 1; Metabolism > Metabolism of Cofactors and Vitamins > ko00830 Retinol metabolism > K07408 cytochrome P450, family 1, subfamily A, polypeptide 1 |
| EC | 1.14.14.1 1.14.99.9 |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
Mtr.12104.1.S1_at
|
| Corresponding NCBI Gene | 823990 |
| Trichome-related Gene from Literature | N/A |