| Detail of EST/Unigene TCMT51164 |
| Acc. | TCMT51164 |
| Internal Acc. | |
| Type | TC/Unigene |
| Annotation (Top 5 hits in Uniprot_trembl) | Ectonucleotide pyrophosphatase/phosphodiesterase family member 1 OS=Mus musculus E-value=2e-22; Ectonucleotide pyrophosphatase/phosphodiesterase family member 1 OS=Homo sapiens E-value=2e-22; Ectonucleotide pyrophosphatase/phosphodiesterase family member 3 OS=Bos taurus E-value=4e-22; Ectonucleotide pyrophosphatase/phosphodiesterase family member 4 OS=Homo sapiens E-value=2e-21; Ectonucleotide pyrophosphatase/phosphodiesterase family member 1 OS=Rattus norvegicus E-value=2e-21; |
| Length | 724 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_GESD (2 ESTs); MT_DFLOWER (2 ESTs); |
| Sequence | GAGGGGTTTTTGAGGATGTTAGTATTATTATGGTTGGTGATCATGGTATGGTTGGTACTT |
| EST members of Unigene | CA989912 BI311251 BQ148640 BQ147887 |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Metabolism > Lipid Metabolism > ko00565 Ether lipid metabolism > K01122 alkylglycerophosphoethanolamine phosphodiesterase; Metabolism > Carbohydrate Metabolism > ko00500 Starch and sucrose metabolism > K01513 nucleotide pyrophosphatase; Metabolism > Nucleotide Metabolism > ko00230 Purine metabolism > K01513 nucleotide pyrophosphatase; Metabolism > Metabolism of Cofactors and Vitamins > ko00760 Nicotinate and nicotinamide metabolism > K01513 nucleotide pyrophosphatase; Metabolism > Metabolism of Cofactors and Vitamins > ko00770 Pantothenate and CoA biosynthesis > K01513 nucleotide pyrophosphatase; Metabolism > Metabolism of Cofactors and Vitamins > ko00740 Riboflavin metabolism > K01513 nucleotide pyrophosphatase |
| EC | 3.1.4.1 3.1.4.39 3.6.1.9 |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
Mtr.44684.1.S1_at, Mtr.713.1.S1_s_at
|
| Corresponding NCBI Gene | 829089 |
| Trichome-related Gene from Literature | N/A |