Detail of EST/Unigene TCMT51399 |
Acc. | TCMT51399 |
Internal Acc. | |
Type | TC/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | Glutathione peroxidase OS=Lactococcus lactis subsp. cremoris (strain MG1363) E-value=2e-33; Glutathione peroxidase OS=Lactococcus lactis subsp. lactis (strain IL1403) E-value=2e-33; Putative glutathione peroxidase OS=Synechocystis sp. (strain PCC 6803 / Kazusa) E-value=2e-29; Glutathione peroxidase homolog BsaA OS=Bacillus halodurans (strain ATCC BAA-125 / DSM 18197 / FERM 7344 / JCM 9153 / C-125) E-value=2e-29; Glutathione peroxidase homolog BsaA OS=Staphylococcus epidermidis (strain ATCC 12228) E-value=4e-29; |
Length | 682 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_SIRRA (3 ESTs); |
Sequence | TGAAGCGCTATACACGAAATACGCCGGTCAAGGGTTAGTGGTGCTTGGCTTTCCCTGTAA |
EST members of Unigene | BQ157683 BQ156150 BQ155559 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Lipid Metabolism > ko00590 Arachidonic acid metabolism > K00432 glutathione peroxidase; Metabolism > Metabolism of Other Amino Acids > ko00480 Glutathione metabolism > K00432 glutathione peroxidase; Metabolism > Metabolism of Other Amino Acids > ko00480 Glutathione metabolism > K05361 phospholipid-hydroperoxide glutathione peroxidase |
EC | 1.11.1.12 1.11.1.9 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
Mtr.11680.1.S1_at
|
Corresponding NCBI Gene | 826765 |
Trichome-related Gene from Literature | N/A |