Detail of EST/Unigene TCMT51709 |
Acc. | TCMT51709 |
Internal Acc. | |
Type | TC/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | unknown |
Length | 659 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_PhoLEAF (1 ESTs); MT_JCVI-MT2 (1 ESTs); MT_BML (1 ESTs); |
Sequence | GGGACTCCTATTGGAGTTAGTTAAAGTTGCTTCTTCGTTTCTCCTTCTTCTACTAAGCAC |
EST members of Unigene | BF637624 GE348282 GD185668 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Lipid Metabolism > ko00565 Ether lipid metabolism > K00655 1-acyl-sn-glycerol-3-phosphate acyltransferase; Metabolism > Lipid Metabolism > ko00561 Glycerolipid metabolism > K00655 1-acyl-sn-glycerol-3-phosphate acyltransferase; Metabolism > Lipid Metabolism > ko00564 Glycerophospholipid metabolism > K00655 1-acyl-sn-glycerol-3-phosphate acyltransferase |
EC | 2.3.1.51 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
Mtr.16823.1.S1_s_at
|
Corresponding NCBI Gene | 836183 |
Trichome-related Gene from Literature | N/A |