| Detail of EST/Unigene TCMT51709 |
| Acc. | TCMT51709 |
| Internal Acc. | |
| Type | TC/Unigene |
| Annotation (Top 5 hits in Uniprot_trembl) | unknown |
| Length | 659 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_PhoLEAF (1 ESTs); MT_JCVI-MT2 (1 ESTs); MT_BML (1 ESTs); |
| Sequence | GGGACTCCTATTGGAGTTAGTTAAAGTTGCTTCTTCGTTTCTCCTTCTTCTACTAAGCAC |
| EST members of Unigene | BF637624 GE348282 GD185668 |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Metabolism > Lipid Metabolism > ko00565 Ether lipid metabolism > K00655 1-acyl-sn-glycerol-3-phosphate acyltransferase; Metabolism > Lipid Metabolism > ko00561 Glycerolipid metabolism > K00655 1-acyl-sn-glycerol-3-phosphate acyltransferase; Metabolism > Lipid Metabolism > ko00564 Glycerophospholipid metabolism > K00655 1-acyl-sn-glycerol-3-phosphate acyltransferase |
| EC | 2.3.1.51 |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
Mtr.16823.1.S1_s_at
|
| Corresponding NCBI Gene | 836183 |
| Trichome-related Gene from Literature | N/A |