Detail of EST/Unigene TCMT51811 |
Acc. | TCMT51811 |
Internal Acc. | |
Type | TC/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | SKP1-like protein 1B OS=Arabidopsis thaliana E-value=2e-21; SKP1-like protein 1A OS=Arabidopsis thaliana E-value=7e-21; SKP1-like protein 11 OS=Arabidopsis thaliana E-value=2e-20; SKP1-like protein 12 OS=Arabidopsis thaliana E-value=6e-20; SKP1-like protein 9 OS=Arabidopsis thaliana E-value=2e-17; |
Length | 663 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_DLEAF (1 ESTs); MT_VILEAF (1 ESTs); |
Sequence | CAAGTTTAAAAAATAGGCCGAGATCTTAACATCATTGCAGGTAATGAAAATGCACTATAG |
EST members of Unigene | BG452817 CX523445 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Genetic Information Processing > Folding, Sorting and Degradation > ko04120 Ubiquitin mediated proteolysis > K03094 S-phase kinase-associated protein 1; Environmental Information Processing > Signal Transduction > ko04350 TGF-beta signaling pathway > K03094 S-phase kinase-associated protein 1; Environmental Information Processing > Signal Transduction > ko04310 Wnt signaling pathway > K03094 S-phase kinase-associated protein 1 |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
Mtr.25631.1.S1_s_at, Mtr.39756.1.S1_at
|
Corresponding NCBI Gene | 834224 |
Trichome-related Gene from Literature | N/A |