| Detail of EST/Unigene TCMT52390 |
| Acc. | TCMT52390 |
| Internal Acc. | |
| Type | TC/Unigene |
| Annotation (Top 5 hits in Uniprot_trembl) | Elongation factor G, mitochondrial OS=Oryza sativa subsp. japonica E-value=2e-17; Elongation factor G, mitochondrial OS=Arabidopsis thaliana E-value=7e-17; Elongation factor G, mitochondrial OS=Dictyostelium discoideum E-value=4e-16; Elongation factor G, mitochondrial OS=Schizosaccharomyces pombe (strain 972 / ATCC 24843) E-value=8e-16; Elongation factor G, mitochondrial OS=Schizosaccharomyces japonicus (strain yFS275 / FY16936) E-value=1e-15; |
| Length | 553 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_TRI (2 ESTs); |
| Sequence | ATAGAAAGAGAAATGCTAGCAACACTCTCTTTTGAGTACTCTCTCTAGCACTCACTCTTT |
| EST members of Unigene | EX530506 EX526247 |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | 3.6.5.3 |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
Mtr.36083.1.S1_at
|
| Corresponding NCBI Gene | 819110 |
| Trichome-related Gene from Literature | N/A |