| Detail of EST/Unigene TCMT52496 |
| Acc. | TCMT52496 |
| Internal Acc. | |
| Type | TC/Unigene |
| Annotation (Top 5 hits in Uniprot_trembl) | Protein kinase C beta type OS=Danio rerio E-value=1e-06; Synaptotagmin-10 OS=Rattus norvegicus E-value=4e-06; Synaptotagmin-10 OS=Pongo abelii E-value=4e-06; Synaptotagmin-10 OS=Mus musculus E-value=4e-06; Synaptotagmin-10 OS=Homo sapiens E-value=4e-06; |
| Length | 487 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MtBC_GLOMUS (2 ESTs); |
| Sequence | CCCCCGGGCTGCAGGTTTCCTTAAATTTATAAAGATGTCTAACGGAACTCTTACAGTAAC |
| EST members of Unigene | AL383997 AL383996 |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Environmental Information Processing > Signal Transduction > ko04020 Calcium signaling pathway > K02677 classical protein kinase C; Environmental Information Processing > Signal Transduction > ko04012 ErbB signaling pathway > K02677 classical protein kinase C; Environmental Information Processing > Signal Transduction > ko04010 MAPK signaling pathway > K02677 classical protein kinase C; Environmental Information Processing > Signal Transduction > ko04011 MAPK signaling pathway - yeast > K02677 classical protein kinase C; Environmental Information Processing > Signal Transduction > ko04070 Phosphatidylinositol signaling system > K02677 classical protein kinase C; Environmental Information Processing > Signal Transduction > ko04370 VEGF signaling pathway > K02677 classical protein kinase C; Environmental Information Processing > Signal Transduction > ko04310 Wnt signaling pathway > K02677 classical protein kinase C |
| EC | 2.7.11.1 2.7.11.13 3.1.3.48 |
| Transcription Factor Family | |
| Transporter Classification Family | 9.A.4 Nicotinamide mononucleotide uptake porter PnuC |
| Probeset |
Mtr.3286.1.S1_at
|
| Corresponding NCBI Gene | 830301 |
| Trichome-related Gene from Literature | N/A |