Detail of EST/Unigene TCMT52580 |
Acc. | TCMT52580 |
Internal Acc. | |
Type | TC/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | Vicilin OS=Pisum sativum E-value=0; Vicilin OS=Vicia faba E-value=0; Provicilin (Fragment) OS=Pisum sativum E-value=0; Convicilin OS=Pisum sativum E-value=0; Beta-conglycinin, beta chain OS=Glycine max E-value=0; |
Length | 1569 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_GESD (83 ESTs); GLSD (4 ESTs); MTPOSE (1 ESTs); |
Sequence | GGAAAATAATTCAAACATTATGGCAATCAAAGCTCCATTTCAACTTTTGATGCTGCTGGG |
EST members of Unigene | CA991403 CA991395 CA991387 CA991327 CA991287 CA991274 CA991249 CA991225 CA991175 CA991125 CA991117 CA991090 CA991074 CA991060 CA991008 CA990988 CA990960 CA990895 CA990853 CA990783 CA990661 CA990605 CA990492 CA990477 CA990417 CA990189 CA990110 CA990071 CA990064 CA990053 CA990014 CA990013 CA989914 CA989868 CA918564 CA918419 CA918418 CA918403 CA918402 CA918390 CA918389 CA918377 CA918376 BI312372 BI312326 BI312246 BI312181 BI312061 BI312055 BI311891 BI311886 BI311754 BI311479 BI311474 BI311434 BI311406 BI311364 BI311258 BI311256 BI311015 BI310998 BI310982 BI310767 BI310680 BI310654 BI310652 BI310608 BI310536 BI310446 BI310366 BI310341 BI310340 BI310319 BI310255 BI310225 BI310210 BI310156 BI310045 BI309995 BI309936 BI309915 BI309839 BI309741 AJ498259 CA989343 CA859042 CA858715 BQ124726 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
Mtr.19932.1.S1_s_at
|
Corresponding NCBI Gene | 821835 |
Trichome-related Gene from Literature | N/A |