| Detail of EST/Unigene TCMT53382 |
| Acc. | TCMT53382 |
| Internal Acc. | |
| Type | TC/Unigene |
| Annotation (Top 5 hits in Uniprot_trembl) | Glutathione S-transferase F9 OS=Arabidopsis thaliana E-value=3e-76; Glutathione S-transferase F10 OS=Arabidopsis thaliana E-value=6e-69; Glutathione S-transferase F11 OS=Arabidopsis thaliana E-value=2e-51; Glutathione S-transferase F12 OS=Arabidopsis thaliana E-value=8e-47; Glutathione S-transferase F13 OS=Arabidopsis thaliana E-value=2e-45; |
| Length | 857 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | GLSD (10 ESTs); |
| Sequence | ATGGTAGTGAAGGTGTATGGTCCCCACTGTGCCTCAGCCAAACGAGTGTTGGTTTGTCTT |
| EST members of Unigene | CA989787 CA989579 CA989524 CA989451 CA989376 CA858169 BQ125015 BQ124626 BQ123696 BQ122418 |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Metabolism > Xenobiotics Biodegradation and Metabolism > ko00982 Drug metabolism - cytochrome P450 > K00799 glutathione S-transferase; Metabolism > Xenobiotics Biodegradation and Metabolism > ko00980 Metabolism of xenobiotics by cytochrome P450 > K00799 glutathione S-transferase; Metabolism > Metabolism of Other Amino Acids > ko00480 Glutathione metabolism > K00799 glutathione S-transferase |
| EC | 2.5.1.18 |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
Mtr.12512.1.S1_at
|
| Corresponding NCBI Gene | 817636 |
| Trichome-related Gene from Literature | N/A |