Detail of EST/Unigene TCMT55236 |
Acc. | TCMT55236 |
Internal Acc. | |
Type | TC/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | Probable glutathione S-transferase OS=Nicotiana tabacum E-value=3e-40; Probable glutathione S-transferase OS=Nicotiana tabacum E-value=2e-39; Probable glutathione S-transferase OS=Nicotiana tabacum E-value=2e-38; Probable glutathione S-transferase OS=Solanum tuberosum E-value=6e-34; Glutathione S-transferase U4 OS=Arabidopsis thaliana E-value=1e-33; |
Length | 451 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MtBC_GLOMUS (1 ESTs); MT_Drought (1 ESTs); |
Sequence | AAGCTATGGCAGATGTGAAACTACTTGGATTTTGGTCTAGTCCTTTTGTTCATAGAGTTA |
EST members of Unigene | AL382291 BE248701 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Xenobiotics Biodegradation and Metabolism > ko00982 Drug metabolism - cytochrome P450 > K00799 glutathione S-transferase; Metabolism > Xenobiotics Biodegradation and Metabolism > ko00980 Metabolism of xenobiotics by cytochrome P450 > K00799 glutathione S-transferase; Metabolism > Metabolism of Other Amino Acids > ko00480 Glutathione metabolism > K00799 glutathione S-transferase |
EC | 2.5.1.18 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
Mtr.37204.1.S1_at
|
Corresponding NCBI Gene | 817495 |
Trichome-related Gene from Literature | N/A |