Detail of EST/Unigene TCMT55574 |
Acc. | TCMT55574 |
Internal Acc. | |
Type | TC/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | Quinone oxidoreductase-like protein At1g23740, chloroplastic OS=Arabidopsis thaliana E-value=3e-83; Quinone-oxidoreductase homolog, chloroplastic OS=Spinacia oleracea E-value=4e-18; Reticulon-4-interacting protein 1, mitochondrial OS=Bos taurus E-value=6e-17; Reticulon-4-interacting protein 1, mitochondrial OS=Mus musculus E-value=8e-17; Putative quinone-oxidoreductase homolog, chloroplastic OS=Arabidopsis thaliana E-value=1e-16; |
Length | 977 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_JAS_ROOR (2 ESTs); |
Sequence | GCAAAATTCAACTTTATATTACATTTAAATACCCTTCATATATATTTTTCTCTAAAAATT |
EST members of Unigene | CX535013 CX531583 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | 1.-.-.- |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
Mtr.18492.1.S1_s_at
|
Corresponding NCBI Gene | 838984 |
Trichome-related Gene from Literature | N/A |