| Detail of EST/Unigene TCMT56775 |
| Acc. | TCMT56775 |
| Internal Acc. | |
| Type | TC/Unigene |
| Annotation (Top 5 hits in Uniprot_trembl) | UDP-glycosyltransferase 73B1 OS=Arabidopsis thaliana E-value=9e-63; UDP-glycosyltransferase 73D1 OS=Arabidopsis thaliana E-value=2e-54; UDP-glycosyltransferase 73C2 OS=Arabidopsis thaliana E-value=3e-54; UDP-glycosyltransferase 73C7 OS=Arabidopsis thaliana E-value=3e-53; UDP-glycosyltransferase 73C6 OS=Arabidopsis thaliana E-value=3e-53; |
| Length | 1221 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_MGHG (1 ESTs); MT_Drought (1 ESTs); MT_JCVI-MT2 (1 ESTs); |
| Sequence | CATGTTCAAGGTACACACTTCAAATATTCTTGAAAGCATCAATTCAGAGACAGAGTTTTT |
| EST members of Unigene | BE942808 BF633558 GE350778 |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Metabolism > Xenobiotics Biodegradation and Metabolism > ko00982 Drug metabolism - cytochrome P450 > K00699 glucuronosyltransferase; Metabolism > Xenobiotics Biodegradation and Metabolism > ko00983 Drug metabolism - other enzymes > K00699 glucuronosyltransferase; Metabolism > Xenobiotics Biodegradation and Metabolism > ko00980 Metabolism of xenobiotics by cytochrome P450 > K00699 glucuronosyltransferase; Metabolism > Carbohydrate Metabolism > ko00040 Pentose and glucuronate interconversions > K00699 glucuronosyltransferase; Metabolism > Carbohydrate Metabolism > ko00500 Starch and sucrose metabolism > K00699 glucuronosyltransferase; Metabolism > Lipid Metabolism > ko00150 Androgen and estrogen metabolism > K00699 glucuronosyltransferase; Metabolism > Metabolism of Cofactors and Vitamins > ko00860 Porphyrin and chlorophyll metabolism > K00699 glucuronosyltransferase; Metabolism > Metabolism of Cofactors and Vitamins > ko00830 Retinol metabolism > K00699 glucuronosyltransferase; |
| EC | 2.4.1.17 2.4.1.47 |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
Mtr.44505.1.S1_at
|
| Corresponding NCBI Gene | 829561 |
| Trichome-related Gene from Literature | N/A |