| Detail of EST/Unigene TCMT57692 |
| Acc. | TCMT57692 |
| Internal Acc. | |
| Type | TC/Unigene |
| Annotation (Top 5 hits in Uniprot_trembl) | Alpha-galactosidase OS=Cyamopsis tetragonoloba E-value=2e-90; Alpha-galactosidase OS=Coffea arabica E-value=1e-83; Alpha-galactosidase OS=Oryza sativa subsp. japonica E-value=2e-72; Alpha-galactosidase A OS=Cellvibrio japonicus (strain Ueda107) E-value=4e-53; Probable alpha-galactosidase OS=Dictyostelium discoideum E-value=2e-51; |
| Length | 948 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_SIRRA (3 ESTs); |
| Sequence | CTTTATTTGGTTTCAATACAATAGTACACTTTTTCTATTGTATTGGACCACATTACAATA |
| EST members of Unigene | BQ156535 BQ153530 BI269407 |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Metabolism > Carbohydrate Metabolism > ko00052 Galactose metabolism > K01189 alpha-galactosidase; Metabolism > Lipid Metabolism > ko00561 Glycerolipid metabolism > K01189 alpha-galactosidase; Metabolism > Lipid Metabolism > ko00600 Sphingolipid metabolism > K01189 alpha-galactosidase; Metabolism > Glycan Biosynthesis and Metabolism > ko00603 Glycosphingolipid biosynthesis - globoseries > K01189 alpha-galactosidase; Metabolism > Glycan Biosynthesis and Metabolism > ko00603 Glycosphingolipid biosynthesis - globoseries > K01204 alpha-N-acetylgalactosaminidase |
| EC | 3.2.1.49 |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
Mtr.45064.1.S1_at
|
| Corresponding NCBI Gene | 830735 |
| Trichome-related Gene from Literature | N/A |