| Detail of EST/Unigene TCMT57860 |
| Acc. | TCMT57860 |
| Internal Acc. | |
| Type | TC/Unigene |
| Annotation (Top 5 hits in Uniprot_trembl) | Uncharacterized AAA domain-containing protein Rv2559c/MT2636 OS=Mycobacterium tuberculosis E-value=8e-08; DNA-dependent ATPase MGS1 OS=Saccharomyces cerevisiae (strain ATCC 204508 / S288c) E-value=2e-07; ATPase WRNIP1 OS=Rattus norvegicus E-value=2e-07; ATPase WRNIP1 homolog C26H5.02c OS=Schizosaccharomyces pombe (strain 972 / ATCC 24843) E-value=3e-07; ATPase WRNIP1 OS=Mus musculus E-value=3e-07; |
| Length | 753 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_ECELL (1 ESTs); MT_LEAF_PHOMA (1 ESTs); MT_Drought (1 ESTs); |
| Sequence | TTCGGCACGAAGGAAAATTGAACCCTCGTAAGTTAATATTTATAATATGAACTTAATCTA |
| EST members of Unigene | BF650825 BQ140196 BF631901 |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Genetic Information Processing > Replication and Repair > ko03030 DNA replication > K10755 replication factor C subunit 2/4; Genetic Information Processing > Replication and Repair > ko03430 Mismatch repair > K10755 replication factor C subunit 2/4; Genetic Information Processing > Replication and Repair > ko03420 Nucleotide excision repair > K10755 replication factor C subunit 2/4 |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
Mtr.42140.1.S1_at
|
| Corresponding NCBI Gene | 839045 |
| Trichome-related Gene from Literature | N/A |