| Detail of EST/Unigene TCMT58478 |
| Acc. | TCMT58478 |
| Internal Acc. | |
| Type | TC/Unigene |
| Annotation (Top 5 hits in Uniprot_trembl) | Cytochrome P450 750A1 OS=Pinus taeda E-value=1e-42; Cytochrome P450 71A1 OS=Persea americana E-value=7e-36; Cytochrome P450 71A21 OS=Arabidopsis thaliana E-value=6e-35; Cytochrome P450 71A22 OS=Arabidopsis thaliana E-value=1e-34; Premnaspirodiene oxygenase OS=Hyoscyamus muticus E-value=2e-34; |
| Length | 895 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_SROOT_KV2 (1 ESTs); MT_SEEDROOT_KV3 (1 ESTs); |
| Sequence | GAAGCACATTTGTTAGGATTTCTCTTTATTTAAATACTAAACAAGTTTCATGTTAAAATA |
| EST members of Unigene | AW774327 AW257434 |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Metabolism > Lipid Metabolism > ko00140 C21-Steroid hormone metabolism > K00512 cytochrome P450, family 17, subfamily A (steroid 17alpha-monooxygenase); Metabolism > Lipid Metabolism > ko00140 C21-Steroid hormone metabolism > K00513 cytochrome P450, family 21, subfamily A (steroid 21-monooxygenase); Metabolism > Xenobiotics Biodegradation and Metabolism > ko00980 Metabolism of xenobiotics by cytochrome P450 > K07408 cytochrome P450, family 1, subfamily A, polypeptide 1; Metabolism > Amino Acid Metabolism > ko00380 Tryptophan metabolism > K07408 cytochrome P450, family 1, subfamily A, polypeptide 1; Metabolism > Metabolism of Cofactors and Vitamins > ko00830 Retinol metabolism > K07408 cytochrome P450, family 1, subfamily A, polypeptide 1 |
| EC | 1.14.14.1 1.14.99.9 |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
Mtr.42234.1.S1_at
|
| Corresponding NCBI Gene | 823990 |
| Trichome-related Gene from Literature | N/A |