| Detail of EST/Unigene TCMT60782 |
| Acc. | TCMT60782 |
| Internal Acc. | |
| Type | TC/Unigene |
| Annotation (Top 5 hits in Uniprot_trembl) | Type I inositol 1,4,5-trisphosphate 5-phosphatase 13 OS=Arabidopsis thaliana E-value=4e-46; Type II inositol 1,4,5-trisphosphate 5-phosphatase 14 OS=Arabidopsis thaliana E-value=1e-44; Type I inositol 1,4,5-trisphosphate 5-phosphatase 12 OS=Arabidopsis thaliana E-value=9e-44; Type II inositol 1,4,5-trisphosphate 5-phosphatase FRA3 OS=Arabidopsis thaliana E-value=4e-37; |
| Length | 756 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_DSTEM2 (3 ESTs); |
| Sequence | CTGAAATCAACACTCCCTATATTCTTTCCGCGCGTTTCGATCTTCATTATCTAATGGATC |
| EST members of Unigene | BE325448 AW697324 AW697071 |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
Mtr.13282.1.S1_at
|
| Corresponding NCBI Gene | 837069 |
| Trichome-related Gene from Literature | N/A |