Detail of EST/Unigene TCMT60782 |
Acc. | TCMT60782 |
Internal Acc. | |
Type | TC/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | Type I inositol 1,4,5-trisphosphate 5-phosphatase 13 OS=Arabidopsis thaliana E-value=4e-46; Type II inositol 1,4,5-trisphosphate 5-phosphatase 14 OS=Arabidopsis thaliana E-value=1e-44; Type I inositol 1,4,5-trisphosphate 5-phosphatase 12 OS=Arabidopsis thaliana E-value=9e-44; Type II inositol 1,4,5-trisphosphate 5-phosphatase FRA3 OS=Arabidopsis thaliana E-value=4e-37; |
Length | 756 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_DSTEM2 (3 ESTs); |
Sequence | CTGAAATCAACACTCCCTATATTCTTTCCGCGCGTTTCGATCTTCATTATCTAATGGATC |
EST members of Unigene | BE325448 AW697324 AW697071 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
Mtr.13282.1.S1_at
|
Corresponding NCBI Gene | 837069 |
Trichome-related Gene from Literature | N/A |