| Detail of EST/Unigene TCMT60911 |
| Acc. | TCMT60911 |
| Internal Acc. | |
| Type | TC/Unigene |
| Annotation (Top 5 hits in Uniprot_trembl) | Serine hydroxymethyltransferase 1 OS=Dictyostelium discoideum E-value=3e-63; Serine hydroxymethyltransferase 2 OS=Dictyostelium discoideum E-value=1e-61; Serine hydroxymethyltransferase, mitochondrial OS=Bos taurus E-value=5e-57; Serine hydroxymethyltransferase, mitochondrial OS=Arabidopsis thaliana E-value=1e-56; Serine hydroxymethyltransferase, mitochondrial OS=Homo sapiens E-value=4e-56; |
| Length | 1416 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_Drought (1 ESTs); MT_NOD_NOLLY (1 ESTs); MT_FLOSEED_MTY (1 ESTs); |
| Sequence | TATTGTGTGACATGGCTCAGATTAGTGGGATAATTGCAGCCAAGGAGTGTGTGAACCCTT |
| EST members of Unigene | DY616756 DW018987 BI268854 |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Metabolism > Energy Metabolism > ko00680 Methane metabolism > K00600 glycine hydroxymethyltransferase; Metabolism > Amino Acid Metabolism > ko00260 Glycine, serine and threonine metabolism > K00600 glycine hydroxymethyltransferase; Metabolism > Metabolism of Other Amino Acids > ko00460 Cyanoamino acid metabolism > K00600 glycine hydroxymethyltransferase; Metabolism > Metabolism of Cofactors and Vitamins > ko00670 One carbon pool by folate > K00600 glycine hydroxymethyltransferase |
| EC | 2.1.2.1 |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
Mtr.25035.1.S1_at
|
| Corresponding NCBI Gene | 838807 |
| Trichome-related Gene from Literature | N/A |