| Detail of EST/Unigene TCNB51043 |
| Acc. | TCNB51043 |
| Internal Acc. | |
| Type | TC/Unigene |
| Annotation (Top 5 hits in Uniprot_trembl) | 3-ketoacyl-CoA thiolase 2, peroxisomal OS=Arabidopsis thaliana E-value=0; 3-ketoacyl-CoA thiolase 1, peroxisomal OS=Arabidopsis thaliana E-value=0; 3-ketoacyl-CoA thiolase 5, peroxisomal OS=Arabidopsis thaliana E-value=0; 3-ketoacyl-CoA thiolase, peroxisomal OS=Homo sapiens E-value=0; 3-ketoacyl-CoA thiolase A, peroxisomal OS=Rattus norvegicus E-value=0; |
| Length | 1591 nt |
| Species | Nicotiana benthamiana |
| Belonged EST Libraries | NB_MTISSUE (10 ESTs); LIBEST_024542 (1 ESTs); NB_SAL_US (1 ESTs); NB_TRI (1 ESTs); |
| Sequence | CATATGAAACTACCATGTGTTCATTTCCTCTCGTTTTATTATCTCATGAGTCCAATAAAT |
| EST members of Unigene | CK288991 CK288990 CK290722 CK290721 EX533858 CK282430 CK282431 CK282432 CK282433 GO608514 CK292962 CK292963 CN746474 |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Metabolism > Xenobiotics Biodegradation and Metabolism > ko00362 Benzoate degradation via hydroxylation > K07513 acetyl-CoA acyltransferase 1; Metabolism > Lipid Metabolism > ko00120 Bile acid biosynthesis > K07513 acetyl-CoA acyltransferase 1; Metabolism > Lipid Metabolism > ko01040 Biosynthesis of unsaturated fatty acids > K07513 acetyl-CoA acyltransferase 1; Metabolism > Lipid Metabolism > ko00071 Fatty acid metabolism > K07513 acetyl-CoA acyltransferase 1; Metabolism > Amino Acid Metabolism > ko00280 Valine, leucine and isoleucine degradation > K07513 acetyl-CoA acyltransferase 1 |
| EC | 2.3.1.16 |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 817876 |
| Trichome-related Gene from Literature | 817876 |