| Detail of EST/Unigene TCNB51696 |
| Acc. | TCNB51696 |
| Internal Acc. | |
| Type | TC/Unigene |
| Annotation (Top 5 hits in Uniprot_trembl) | Chlorophyll a-b binding protein 21, chloroplastic OS=Nicotiana tabacum E-value=0; Chlorophyll a-b binding protein 1B, chloroplastic OS=Solanum lycopersicum E-value=0; Chlorophyll a-b binding protein 16, chloroplastic OS=Nicotiana tabacum E-value=0; Chlorophyll a-b binding protein 50, chloroplastic OS=Nicotiana tabacum E-value=0; Chlorophyll a-b binding protein 40, chloroplastic OS=Nicotiana tabacum E-value=0; |
| Length | 939 nt |
| Species | Nicotiana benthamiana |
| Belonged EST Libraries | NB_SAL_US (39 ESTs); |
| Sequence | GAAACACAACAAATCTCATTATATTGTCAGGTGACTCACAACAGCTTTACAAGGCCATCA |
| EST members of Unigene | CN742221 CN655433 CN744012 CN745973 CN745975 CN745389 CN745590 CN741462 CN741631 CN743795 CN746690 CN743565 CN745530 CN743192 CN742199 CN745944 CN746143 CN747304 CN745396 CN742649 CN744043 CN747221 CN743125 CN744126 CN748033 CN744132 CN742353 CN745307 CN655156 CN746639 CN744099 CN744049 CN744246 CN745226 CN742476 CN655079 CN746214 CN742291 CN743482 |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 839871 |
| Trichome-related Gene from Literature | 839871 |