| Detail of EST/Unigene TCNB51980 |
| Acc. | TCNB51980 |
| Internal Acc. | |
| Type | TC/Unigene |
| Annotation (Top 5 hits in Uniprot_trembl) | Trans-cinnamate 4-monooxygenase OS=Catharanthus roseus E-value=0; Trans-cinnamate 4-monooxygenase OS=Populus kitakamiensis E-value=0; Trans-cinnamate 4-monooxygenase OS=Populus tremuloides E-value=0; Trans-cinnamate 4-monooxygenase OS=Helianthus tuberosus E-value=0; Trans-cinnamate 4-monooxygenase OS=Zinnia elegans E-value=0; |
| Length | 755 nt |
| Species | Nicotiana benthamiana |
| Belonged EST Libraries | LIBEST_024542 (39 ESTs); |
| Sequence | AAAACACCCATTTCTCCCCCCCATAAAAACTGTTTCTCTCGTCTAAAATGGATCTTCTCT |
| EST members of Unigene | GO601732 GO604927 GO605995 GO602888 GO604496 GO601253 GO601316 GO605785 GO608136 GO602178 GO601586 GO605076 GO607020 GO606825 GO604307 GO602818 GO605329 GO607949 GO602282 GO600837 GO600276 GO601202 GO608435 GO604868 GO604360 GO603834 GO608354 GO602802 GO605385 GO606512 GO607162 GO601661 GO601816 GO603961 GO603967 GO604951 GO607293 GO604031 GO608201 |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Metabolism > Xenobiotics Biodegradation and Metabolism > ko00980 Metabolism of xenobiotics by cytochrome P450 > K07408 cytochrome P450, family 1, subfamily A, polypeptide 1; Metabolism > Amino Acid Metabolism > ko00380 Tryptophan metabolism > K07408 cytochrome P450, family 1, subfamily A, polypeptide 1; Metabolism > Metabolism of Cofactors and Vitamins > ko00830 Retinol metabolism > K07408 cytochrome P450, family 1, subfamily A, polypeptide 1; Metabolism > Xenobiotics Biodegradation and Metabolism > ko00982 Drug metabolism - cytochrome P450 > K07413 cytochrome P450, family 2, subfamily C; Metabolism > Xenobiotics Biodegradation and Metabolism > ko00980 Metabolism of xenobiotics by cytochrome P450 > K07413 cytochrome P450, family 2, subfamily C; Metabolism > Lipid Metabolism > ko00590 Arachidonic acid metabolism > K07413 cytochrome P450, family 2, subfamily C; Metabolism > Lipid Metabolism > ko00591 Linoleic acid metabolism > K07413 cytochrome P450, family 2, subfamily C; Metabolism |
| EC | 1.14.14.1 |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 817599 |
| Trichome-related Gene from Literature | 817599 |