Detail of EST/Unigene TCNB52054 |
Acc. | TCNB52054 |
Internal Acc. | |
Type | TC/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | Chlorophyll a-b binding protein 16, chloroplastic OS=Nicotiana tabacum E-value=0; Chlorophyll a-b binding protein 40, chloroplastic OS=Nicotiana tabacum E-value=0; Chlorophyll a-b binding protein E, chloroplastic OS=Nicotiana plumbaginifolia E-value=0; Chlorophyll a-b binding protein 3C, chloroplastic OS=Solanum lycopersicum E-value=0; Chlorophyll a-b binding protein 50, chloroplastic OS=Nicotiana tabacum E-value=0; |
Length | 696 nt |
Species | Nicotiana benthamiana |
Belonged EST Libraries | NB_SAL_US (22 ESTs); |
Sequence | CTTTATCACTTCAGCCATCAGAAAACTCTTCATTCTCCTTATTAAGCCATGGCTGCTTCT |
EST members of Unigene | CN745779 CN748325 CN655424 CN746151 CN742020 CN744780 CN748891 CN742187 CN747477 CN742162 CN745191 CN746177 CN747445 CN746844 CN748217 CN742724 CN745855 CN744873 CN744676 CN744643 CN745808 CN748729 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 839871 |
Trichome-related Gene from Literature | 839871 |